Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Q. 24

Page 392

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Q. 25

Page 392

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.

Q. 26

Page 393

Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.

Q.27

Page 393

Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

Q. 28

Page 393

Explain how single nucleotide changes can have vastly different effects on protein function.

Q. 29

Page 393

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Q. 3

Page 391

Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Q. 4

Page 391

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy

Q.6

Page 391

Which event contradicts the central dogma of molecular biology?

a. Poly-A polymerase enzymes process mRNA in the nucleus.

b. Endonuclease enzymes splice out and repair damaged DNA.

c. Scientists use reverse transcriptase enzymes to make DNA from RNA.

d. Codons specifying amino acids are degenerate and universal.

Q. 7

Page 391

Which subunit of the E. coli polymerase confers specificity to transcription?

a. α

b. β

c. β'

d. σ

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks