Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Q. 15

Page 392

A scientist identifies a pre-mRNA with the following structure.

What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail? a. 220bp b. 295bp c. 140bp d. 435bp.

Q. 16

Page 392

The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum

Q. 17

Page 392

In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200

Q. 18

Page 392

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? a. Translation stalls after the initiation AUG codon is identified. b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites. c. The ribosome cannot interact with mRNAs. d. tRNAs cannot exit the E site of the ribosome

Q.19

Page 392

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

Q. 2

Page 391

Figure 15.13Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.

Q.20

Page 392

Discuss how degeneracy of the genetic code makes cells more robust to mutations.

Q. 21

Page 392

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Q. 22

Page 392

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

Q. 23

Page 392

In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks