Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

1.question

Page 391

Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?

20.question

Page 392

Discuss how degeneracy of the genetic code makes cells more robust to mutations.

21.question

Page 392

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

22.question

Page 392

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

23.question

Page 392

In your own words, describe the difference between rho dependent and rho-independent termination of transcription in prokaryotes.

24.question

Page 392

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

25.question

Page 392

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect ?

2.question

Page 391

Figure 15.13 Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.

3.question

Page 391

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

4.question

Page 391

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks