Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Problem 1

The affinity of a macromolecular interaction reflects the strength of an interaction for one receptor relative to all other possible receptors. True/False

Problem 2

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

Problem 3

Specificity depends on the concentration of ligand, whereas affinity is independent of ligand concentration. True/False

Problem 5

Which of the following statements regarding interfacial waters is true? a. They contribute favorably to the entropy of protein-protein recognition. b. They help to optimize the packing at the contact surface. c. They contribute only to affinity, but not to the specificity of protein- protein recognition. d. There are typically fewer water-mediated hydrogen bonds than direct hydrogen bonds at protein-protein interfaces.

Problem 6

Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

Problem 15

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

Problem 17

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

Problem 20

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

Problem 22

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Problem 24

A complex of seven transcription factors binds a DNA enhancer element. The binding is cooperative. What are two molecular mechanisms that the transcription factors might use to achieve this cooperativity?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks