Question

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Short answer

The complementary strand is \( \left(3^{\prime}\right) \text{CGC GTTATAAAGAGTTTTATAACGCG} \left(5^{\prime}\right)\). It contains palindromic sequences that may form alternative structures.

Step-by-step solution

Understanding DNA Base Pairing

DNA strands pair through specific base pairing: guanine (G) pairs with cytosine (C), and adenine (A) pairs with thymine (T). When given a DNA strand, its complementary strand is formed by replacing each base with its pair.

Writing the Complementary Sequence

Given the sequence \( \text{GCG CAATATTTCTCAAAATATTGCGC} \), replace each base using the rules of base pairing: G with C, C with G, A with T, and T with A. This gives the complementary sequence \( \left(3^{\prime}\right)\) CGC GTTATAAAGAGTTTTATAACGCG \(\left(5^{\prime}\right)\).

Identifying Special Sequence Type

The given and complementary sequences have regions that are palindromic. A palindromic sequence reads the same in one direction on one strand as the opposite direction on the complementary strand. For example, the sequence "GCGC" is palindromic.

Evaluating Alternative DNA Structures

Palindromic sequences in DNA can allow for the formation of alternative structures like hairpins, cruciforms, or four-way junctions, which can occur due to the ability of the strands to fold back on themselves.

Key concepts

Complementary DNA Strands

In DNA, the two strands are complementary to each other. This means that each base on one strand pairs with a specific base on the other strand. These pairs are:

• Guanine (G) pairs with Cytosine (C)
• Adenine (A) pairs with Thymine (T)

Understanding this pairing allows us to deduce the complementary strand if one strand's sequence is given. For instance, if you have a DNA sequence such as 5'-GCG CAATATTTCTCAAAATATTGCGC-3', you can find the complementary sequence by pairing each base with its partner. Starting from the 3' end, the complementary sequence reads oppositely as 3'-CGC GTTATAAAGAGTTTTATAACGCG-5'. This systematic pairing ensures the uniform width and stability of the DNA helical structure.
Base pairing is crucial for DNA replication, allowing the genetic information to be accurately passed on from one generation to the next.

Palindromic Sequences in DNA

Palindromic sequences are quite fascinating as they read the same forward on one strand as they do backward on the complementary strand. If you think of a palindrome in language, like the word "radar," it's similar in DNA. In the provided DNA sequence, regions like "GCGC" exhibit palindromic characteristics. This mirroring can be important for the cell's biological functions.
In nature, palindromic sequences are often associated with crucial biological processes. They can be recognized by enzymes, which cut DNA, called restriction enzymes. These enzymes use the palindrome-like patterns in DNA to identify specific sites to interact with. Additionally, palindromic sequences can contribute to genetic stability and variability.

Alternative DNA Structures

DNA is not just a rigid double helix, but is quite flexible and can form a variety of alternative shapes under certain conditions. These structures come into play more prominently when there are palindromic sequences. Consider hairpins and cruciforms:

• Hairpins: Occur when single-stranded DNA loops back on itself, forming a pin-shaped structure.
• Cruciforms: Occur in double-stranded DNA, creating a cross shape when both strands contain palindromes.

These alternative DNA forms are significant because they can alter how genes are expressed and can play roles in the regulation of genetic processes. For example, they can facilitate certain protein interactions or assist in controlling the activities of genetic regulatory elements. Understanding these structures aids scientists in studying genetic disorders and DNA-based technology development, such as gene editing.