Question

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Short answer

At positions with codons AUG and UGG, no changes can occur without altering the amino acid. For the others, changes depend on permissible codon variations within the same amino acid.

Step-by-step solution

Identify the Codons

First, we need to identify the codons from the RNA sequence. A codon is a sequence of three nucleotides that corresponds to a specific amino acid. The provided RNA sequence is: (5') AUG AUA UUG CUA UCU UGG ACU. This sequence can be broken down into the following codons: 1. AUG 2. AUA 3. UUG 4. CUA 5. UCU 6. UGG 7. ACU.

Translate Codons to Amino Acids

Next, translate each codon into its corresponding amino acid using the genetic code table: 1. AUG - Methionine (Start codon) 2. AUA - Isoleucine 3. UUG - Leucine 4. CUA - Leucine 5. UCU - Serine 6. UGG - Tryptophan 7. ACU - Threonine.

Assess for Synonymous Mutations

Determine which nucleotides in each codon can change without altering the amino acid. This is due to the redundancy of the genetic code, where multiple codons can encode for the same amino acid. - For **AUG (Methionine)**: No changes allowed; only codon. - For **AUA (Isoleucine)**: The third position can change to C or U (AUC, AUU) for Isoleucine. - For **UUG (Leucine)** and **CUA (Leucine)**: Various positions can change (e.g., UUA, CUG, etc.). - For **UCU (Serine)**: The third position can change to C, A, or G (UCC, UCA, UCG). - For **UGG (Tryptophan)**: No changes allowed; only codon. - For **ACU (Threonine)**: The third position can change to C, A, G (ACC, ACA, ACG).

Summarize Synonymous Changes

List the synonymous changes for each codon: - **AUG**: No changes. - **AUA**: AUC, AUU. - **UUG**: UUA, CUG, CUC, CUU, CUA. - **CUA**: UUG, CUG, CUC, CUU, UUA. - **UCU**: UCC, UCA, UCG. - **UGG**: No changes. - **ACU**: ACC, ACA, ACG.

Key concepts

Synonymous Mutations

Synonymous mutations are changes in the genetic code that do not lead to a change in the amino acid sequence of a protein. Since multiple codons can code for the same amino acid, these mutations are considered "silent." For example, the codons UUA, UUG, CUA, CUC, CUG, and CUU all encode for the amino acid leucine.

If a mutation occurs in one of these codons, like changing CUA to CUU, the same amino acid will still be produced. Therefore, synonymous mutations do not affect protein function.

Importantly, not all codons have synonymous mutations. Codons like AUG (Methionine) and UGG (Tryptophan) cannot undergo synonymous mutations because there's only one way to build these amino acids.

Codon Redundancy

Codon redundancy refers to the genetic code's ability to use multiple codons to specify the same amino acid. This feature often provides a level of protection against mutations.

Codons are clusters of three nucleotides; with four nucleotide options (A,U,C,G) available for each position, there are 64 possible codons. However, these codons map onto only 20 amino acids plus stop signals, illustrating redundancy.

For example, for isoleucine, the codons AUA, AUU, and AUC can all encode the same amino acid. This built-in redundancy means that point mutations, which change a single nucleotide, might not result in a different amino acid and hence, may be harmless.

Translation of RNA

Translation is the biological process where ribosomes synthesize proteins using mRNA as a template. This process consists of initiating, elongation, and termination steps, translating nucleotide sequences into functional proteins.

1. **Initiation**: It starts when the ribosome binds to the mRNA at the start codon (always AUG, coding for methionine). 2. **Elongation**: The ribosome reads the mRNA in groups of three nucleotides, or codons, adding the matching amino acids and extending the polypeptide chain.
3. **Termination**: The process ends when a stop codon (e.g., UAA, UAG, UGA) is reached, releasing the protein for folding and function.

Each stage is crucial for accurate protein synthesis, and errors can lead to dysfunctional proteins.

Amino Acid Coding

Amino acid coding is the process of identifying the sequence of amino acids based on the mRNA's codons. This coding is essential for building the proteins that perform various functions in cells.

The genetic code dictionary shows which codon sequences correspond to specific amino acids and is universal among almost all organisms, underscoring the evolutionary conservation of life's building blocks.

For instance, if the codon is UGU or UGC, it codes for the amino acid cysteine. This precise coding ensures that proteins are built with the correct sequence of amino acids, crucial for their structure and function.

Misplaced or changed amino acids due to a coding error could greatly alter a protein's function or render it nonfunctional altogether.