Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Problem 1

Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. a. GGUCAGUCGCUCCUGAUU b. UUGGAUGCGCCAUAAUUUGCU c. CAUGAUGCCUGUUGCUAC d. AUGGACGAA

Problem 2

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Problem 3

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Problem 4

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG \(\left(3^{\prime}\right)\) a. What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5 ' end? c. If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Problem 5

The Genetic Code and Mutation A mutation occasionally arises that converts a codon specifying an amino acid to a stop or nonsense codon. When this occurs in the middle of a gene, the resulting protein is truncated and often inactive. If the protein is essential, cell death can result. Which of these secondary mutations might restore some or all of the protein function so that the cell can survive (there may be more than one correct answer)? a. A mutation restoring the codon to one encoding the original amino acid b. A mutation changing the nonsense codon to one encoding a different but similar amino acid c. A mutation in the anticodon of a tRNA such that the tRNA now recognizes the nonsense codon d. A mutation in which an additional nucleotide inserts just upstream of the nonsense codon, changing the reading frame so the nonsense codon is no longer read as "stop"

Problem 6

The Direction of Protein Synthesis In 1961, Howard Dintzis established that protein synthesis on ribosomes begins at the amino terminus and proceeds toward the carboxyl terminus. He used immature red blood cells that were still synthesizing hemoglobin. He added radioactively labeled leucine (chosen because it occurs frequently in both the \(a\) and \(\beta\) subunits) for various lengths of time, rapidly isolated only the full-length (completed) \(a\) subunits, and then determined where in the peptide the labeled amino acids were located. After the labeled leucine and extract had been incubated together for one hour, the protein was labeled uniformly along its length. However, after much shorter incubation times, the labeled amino acids were clustered at one end. At which end, amino or carboxyl terminus, did Dintzis find the labeled residues after the short exposure to labeled leucine?

Problem 7

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Problem 8

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Problem 9

Synthetic mRNAs The genetic code was elucidated through the use of polyribonucleotides synthesized either enzymatically or chemically in the laboratory. Given what we now know about the genetic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and for a small number of Leu and Ser residues? What other amino acid(s) would be encoded by this polyribonucleotide, but in smaller amounts?

Problem 11

Predicting Anticodons from Codons Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}\), GGA, and GGG. a. From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? b. Which of these anticodon-codon pairings has/have a wobbly base pair? c. In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks