Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{\prime}\) TTCTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer 5 ' TCGAATTGCCAATGAAGGTCCG \(3^{\text {' }}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)

Short Answer

Expert verified
Primers (a) have different Tms; primers (b) have high GC content; primers (c) are reverse complements and can anneal to each other.

Step by step solution

01

Identify the issue in Primer Pair (a)

Examine both the forward and reverse primers for issues such as melting temperature (Tm) differences, GC content, or potential for secondary structure formation.Forward primer: \(5^{\text{'}} \text{GCCTCCGGAGACCCATTGG} 3^{\text{'}}\) Reverse primer: \(5^{\text{'}} \text{TTCTAAGAAACTGTTAAGG} 3^{\text{'}}\)Notice that the forward primer is significantly longer than the reverse primer, which leads to very different melting temperatures, potentially causing inefficiencies in the PCR reaction.
02

Identify the issue in Primer Pair (b)

Check both primers for high GC content, hairpin formations or primer-dimer potential.Forward primer: \(5^{\text{'}} \text{GGGGCCCCTCACTCGGGGCCCC} 3^{\text{'}}\)Reverse primer: \(5^{\text{'}} \text{TCGGCGGCCGTGGCCGAGGCAG} 3^{\text{'}}\)These primers have extremely high GC content, which can lead to strong secondary structures like hairpins or dimers, making them inefficient for PCR.
03

Identify the issue in Primer Pair (c)

Look for complementary sequences within the primer pair that could bind to each other rather than the target DNA.Forward primer: \(5^{\text{'}} \text{TCGAATTGCCAATGAAGGTCCG} 3^{\text{'}}\)Reverse primer: \(5^{\text{'}} \text{CGGACCTTCATTGGCAATTCGA} 3^{\text{'}}\)These primers are reverse complements of each other, meaning they can bind to each other rather than the target DNA, rendering them ineffective.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

primer design
Primer design is a critical step in ensuring successful PCR (Polymerase Chain Reaction) amplification. Primers are short sequences of nucleotides that provide a starting point for DNA synthesis. Incorrectly designed primers can lead to inefficient amplification or the creation of non-specific products. Key considerations in primer design include:

- Primer length: Typically, primers are about 18-25 nucleotides long.
- Specificity: Primers should specifically bind to the target DNA sequence.
- Melting temperature (Tm): The forward and reverse primers should have similar Tm values for optimal annealing.
- Avoid secondary structures: Primers should not form hairpins or dimers.

Effective primer design ensures successful amplification with high specificity and efficiency.
melting temperature
Melting temperature (Tm) is the temperature at which half of the DNA duplex will dissociate to become single-stranded, and it is a key parameter in PCR. Tm is influenced by the length and nucleotide composition of the primer. The formula to estimate Tm is:

\(\text{Tm} = 4(\text{G}+\text{C}) + 2(\text{A}+\text{T}) °C\).

The forward and reverse primers should have similar Tm values, typically within 2-3°C of each other. This ensures that both primers anneal efficiently to the template DNA during the PCR process. If Tm values differ significantly, one primer might not bind as well, leading to poor amplification.
GC content
GC content refers to the percentage of nucleotides in a DNA sequence that are either guanine (G) or cytosine (C). GC pairs are held together by three hydrogen bonds, making them stronger and more stable than AT pairs, which have only two.

A balanced GC content, typically between 40-60%, is ideal for primer design. Too high GC content can lead to strong secondary structures like hairpins or primer-dimers, which hinder the PCR process. Conversely, too low GC content can result in weaker primer binding. Keeping GC content balanced ensures stronger, more specific primer-template hybridization, aiding efficient PCR amplification.
secondary structures
Secondary structures are unwanted formations that can occur within primers, such as hairpins and dimers. These structures form when primers fold back on themselves or bind to each other, blocking primer-template binding and reducing PCR efficiency.

- Hairpins: Formed by intra-primer binding, creating a stem-loop structure.

- Dimers: Formed by inter-primer binding, resulting in primer-primer interactions.

Avoiding secondary structures can be achieved by carefully analyzing the primer sequences for complementary regions that might lead to these unwanted formations. Tools like primer design software can help identify and eliminate problematic sequences, ensuring efficient and specific PCR amplification.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free