Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Problem 36

What difficulties arise in the polymerase chain reaction if there is contamination of the DNA that is to be copied?

Problem 37

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{\prime}\) TTCTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer 5 ' TCGAATTGCCAATGAAGGTCCG \(3^{\text {' }}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)

Problem 43

Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.

Problem 44

Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino acid sequence. Suggest several reasons why this is so.

Problem 46

A recent television commercial featuring seventime Tour de France winner Lance Armstrong talked about the possibility of people carrying a DNA genotype card with them that would contain all of the information necessary to predict future diseases. This could, therefore, be used to help prescribe drugs to stop a medical condition before it became apparent. Give a couple of specific examples of how this ability could be used for the benefit or the detriment of humankind.

Problem 47

What is the difference between the genome and the proteome?

Problem 50

If you wanted to study the nature of transcription in yeast under aerobic versus anaerobic conditions, how could you use DNA microarrays to accomplish this?

Problem 52

What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks