Chapter 29: Problem 1
The sequence of part of an mRNA is \(5^{\prime}-\) AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?
Short Answer
Expert verified
DNA coding: 5'-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3'; DNA template: 3'-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5'.
Step by step solution
01
Identifying the mRNA Strand
The given mRNA strand is \[5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3'\] This is the sequence we need to use to find both the DNA coding and template strands.
02
Determining the DNA Coding Strand
The DNA coding strand is complementary to the DNA template strand but has the same sequence as the mRNA, except by substituting uracil (U) with thymine (T). Thus, it is: \[5' - ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG - 3'\]
03
Determining the DNA Template Strand
The DNA template strand is complementary to the mRNA strand. Match G with C, C with G, A with T, and U with A. The sequence is:\[3' - TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC - 5'\]
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with Vaia!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
mRNA sequence
The mRNA sequence represents a critical step in the process by which genetic information from DNA is used to create proteins. This molecule, also known as messenger RNA, carries the genetic instructions from the DNA in the nucleus to the ribosome, where protein synthesis occurs. In the context of our exercise, the mRNA sequence given is \(5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3'\).
The mRNA sequence is characterized by its four nucleotide bases: adenine (A), uracil (U), cytosine (C), and guanine (G). Unlike DNA, mRNA contains uracil instead of thymine. The sequence of mRNA is complementary to the DNA template strand and is built during the process of transcription.
This sequence is crucial because it dictates the specific sequence of amino acids that will form proteins. It does so by reading sets of three nucleotides at a time, called codons, each of which specifies a particular amino acid. For example, the codon AUG typically signals the start of protein synthesis.
The mRNA sequence is characterized by its four nucleotide bases: adenine (A), uracil (U), cytosine (C), and guanine (G). Unlike DNA, mRNA contains uracil instead of thymine. The sequence of mRNA is complementary to the DNA template strand and is built during the process of transcription.
This sequence is crucial because it dictates the specific sequence of amino acids that will form proteins. It does so by reading sets of three nucleotides at a time, called codons, each of which specifies a particular amino acid. For example, the codon AUG typically signals the start of protein synthesis.
DNA coding strand
The DNA coding strand is one of the two strands of a DNA double helix. Despite its name, it does not directly participate in the transcription process. Instead, it is called the coding strand because its sequence is identical to the mRNA sequence, except that it has thymine (T) instead of uracil (U).
In the provided exercise, the DNA coding strand sequence corresponding to the given mRNA is \(5' - ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG - 3'\). This sequence can be directly inferred from the mRNA by replacing U with T, providing a clear link between the mRNA and the genetic code found in the DNA.
This strand serves as a reference point and helps in understanding the sequence of the gene being expressed. It also highlights how genetic information remains consistent between DNA and RNA, with the coding strand demonstrating the continuity of the genetic message.
In the provided exercise, the DNA coding strand sequence corresponding to the given mRNA is \(5' - ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG - 3'\). This sequence can be directly inferred from the mRNA by replacing U with T, providing a clear link between the mRNA and the genetic code found in the DNA.
This strand serves as a reference point and helps in understanding the sequence of the gene being expressed. It also highlights how genetic information remains consistent between DNA and RNA, with the coding strand demonstrating the continuity of the genetic message.
DNA template strand
The DNA template strand is the strand of DNA that is used by RNA polymerase to create an mRNA molecule during transcription. This strand is complementary to both the mRNA and the DNA coding strand, meaning that nucleotide bases pair in a specific manner: adenine (A) pairs with thymine (T), cytosine (C) pairs with guanine (G), and uracil (U) in RNA pairs with adenine (A) in DNA.
In the context of the provided exercise, the DNA template strand corresponding to the given mRNA sequence is \(3' - TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC - 5'\). This strand is crucial in the transcription process because it determines the sequence of the mRNA.
The DNA template strand's role is foundational because it ensures that the genetic information is copied accurately from DNA to RNA, which then leads to the synthesis of correctly ordered proteins.
In the context of the provided exercise, the DNA template strand corresponding to the given mRNA sequence is \(3' - TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC - 5'\). This strand is crucial in the transcription process because it determines the sequence of the mRNA.
The DNA template strand's role is foundational because it ensures that the genetic information is copied accurately from DNA to RNA, which then leads to the synthesis of correctly ordered proteins.
Transcription
Transcription is a fundamental biological process by which the information in a segment of DNA is copied into mRNA. This process occurs in the cell nucleus and is the first step in the expression of genes leading to protein synthesis. During transcription, RNA polymerase binds to the DNA template strand and constructs the mRNA molecule by reading the template strand in a 3' to 5' direction.
Key players in this process include:
Overall, transcription is essential because it is the mechanism through which the cell translates genetic instructions into functioning proteins. Understanding transcription allows us to grasp how cells execute a wide variety of functions based on genetic information.
Key players in this process include:
- **RNA polymerase:** An enzyme that synthesizes mRNA from the DNA template.
- **Promoter regions:** Specific sequences on the DNA that signal RNA polymerase where to start transcription.
- **Terminator sequences:** These indicate where transcription should stop.
Overall, transcription is essential because it is the mechanism through which the cell translates genetic instructions into functioning proteins. Understanding transcription allows us to grasp how cells execute a wide variety of functions based on genetic information.