Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGIATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Short Answer

Expert verified
The sequences can be lined up as: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA and GTATGTTATCGAAAAGTAGCAAAATAGGGCGIATAGCTACCCAGACTACCGGAT. The homologous region is ATCGAAAATAGGGCGATAGCTA.

Step by step solution

01

Identify Common Sequences

In the two given sequences, identify any similar patterns that begin and end at the same points. It's crucial to carefully review each DNA sequence for any homologous regions.
02

Align Sequences

Once the common sequences have been identified, align the sequences according to these homologous regions. This can be done from left to right or from right to left. The important thing is to keep the similar parts aligned with each other. This comparison will make it easier to visualize the origin of the sequences.
03

Evidence of Homology

Upon correct alignment, the homologous regions will overlap. These overlapping regions provide evidence for homology. The more similar the sequences are, the closer the relation between the two sequences. Another minor difference could imply that minor changes occurred over time.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Homologous Genes
When we talk about homologous genes, we refer to those that are related by descent from a common ancestral DNA sequence. This relationship is often the result of speciation, where species diverge from a common ancestor, and the genes retain patterns of similarity.

For example, in the exercise provided, the two DNA sequences are from homologous genes. Although they may not match perfectly, they will have regions that are conserved across different organisms or, in this case, two gene sequences. These conserved sequences indicate a shared lineage and can provide insights into the evolutionary process. Recognition of these conserved elements is one of the fundamental tasks when studying genomics and evolutionary biology.

The role of homologous genes extends beyond identifying lineage, as they can also help in predicting the function of a gene in a new species based on known functions in other organisms. Understanding homologous genes is crucial not only for genetic research but also for applications in biotechnology, medicine, and conservation biology.
Identifying Common Sequences
Identifying common sequences between DNA strands is a critical step in studying homology. It involves looking for patterns, motifs, or segments that are conserved across different, yet related, DNA sequences.

In the context of our textbook exercise, the first step is to meticulously compare the two DNA sequences to find any sections that are similar. This requires careful attention to detail, as the sequences may contain several regions of similarity scattered across their length. Once these common sequences are identified, they act as markers for alignment and provide a foundation for further comparison.

Tools and algorithms, such as BLAST (Basic Local Alignment Search Tool), are often used by researchers to aid in identifying common sequences across vast databases of genetic information. With such tools, scientists can align sequences from multiple species quickly to uncover evolutionary patterns.
Evidence of Homology
Correctly aligned genetic sequences reveal regions of overlap or similarity that are considered evidence of homology. These similarities can suggest common ancestry or shared evolutionary paths.

In our solved problem, once the sequences are aligned, similarities in the overlapping regions substantiate the theory of homologous genes. The extent of similarity can illuminate how closely related the species might be, and differences might indicate genetic variations that occurred over time—mutations, insertions, deletions, or other genetic modifications.

However, it's important to note that not all similarities indicate homology; they may sometimes be the result of convergent evolution or parallel evolution where different species develop similar traits independently. Therefore, it is necessary to use comparative analysis with additional sequences or utilize other pieces of biological information to confirm homology.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free