Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Problem 11

Discuss the major differences among allopatric, parapatric, and sympatric speciation.

Problem 12

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGIATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Problem 13

What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

Problem 14

Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

Problem 15

Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

Problem 16

When comparing the coding regions of a protein-encoding gene among closely related species, certain regions are commonly found to have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions. Explain why different regions of a protein-encoding gene evolve at different rates.

Problem 17

Plant seeds contain storage proteins that are encoded by the plant's genes. When a seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polypeptides are broken), which releases amino acids for the developing seedling. Would you expect the genes that encode plant storage proteins to evolve more slowly or more rapidly than genes that encode enzymes? Explain your answer.

Problem 19

Compare and contrast the neutral theory of evolution and the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution.

Problem 20

for each of the following examples, discuss whether the observed result is due to neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of homologous genes, differences in the coding sequence are most common at the wobble base (i.e., the third base in each codon). B. For a protein-encoding gene, the regions that encode portions of the polypeptide that are vital for structure and function are less likely to display mutations than other regions of the gene. C. When comparing the sequences of homologous genes, introns usually have more sequence differences than exons.

Problem 21

As discussed in Chapter 27, genetic variation is prevalent in natural populations. This variation is revealed in the DNA sequencing of genes. Based on the neutral theory of evolution, discuss the relative importance of natural selection against detrimental mutations, natural selection in favor of beneficial mutations, and neutral mutations in accounting for the genetic variation we see in natural populations.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks