Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

The nucleotide sequence of a segment of DNA is: \(3^{\prime} \mathrm{T} \mathrm{AC} \mathrm{AAATC} \mathrm{T} \mathrm{C} \mathrm{AT} \mathrm{T} \mathrm{G} \mathrm{T} \mathrm{AT} \mathrm{A} \mathrm{G} \mathrm{G} \mathrm{A} 5^{\prime}\) a) What is the base sequence in the complementary strand? b) If transcription occurs from the 3 ' end of the strand, what is the mRNA base sequence? c) What are the amino acids represented by the sequence?

Short Answer

Expert verified
a) The complementary DNA strand is: \(5^{\prime} \mathrm{ATGTTTAGAGTAAACATATCCT} 3^{\prime}\) b) The mRNA base sequence is: \(5^{\prime} \mathrm{AUGUUUAGAGUAAACAUATCCU} 3^{\prime}\) c) The amino acids represented by the sequence are: Methionine, Phenylalanine, Arginine, Valine, Asparagine, Isoleucine, and Serine.

Step by step solution

01

Identify the given DNA strand

The provided DNA strand is: \(3^{\prime} \mathrm{TACAAATCTCATTTGTATAGGA} 5^{\prime}\)
02

Apply the base-pairing rules for DNA

The base-pairing rules for DNA are as follows: - Adenine (A) pairs with Thymine (T) - Thymine (T) pairs with Adenine (A) - Cytosine (C) pairs with Guanine (G) - Guanine (G) pairs with Cytosine (C) Using these rules, we can determine the complementary DNA strand.
03

Write the complementary DNA strand

The complementary DNA strand is: \(5^{\prime} \mathrm{ATGTTTAGAGTAAACATATCCT} 3^{\prime}\) So, the complementary strand is: \(5^{\prime} \mathrm{ATGTTTAGAGTAAACATATCCT} 3^{\prime}\) #b) Finding the mRNA base sequence#
04

Recognize that transcription occurs from the 3' end of the given strand

Transcription uses the given DNA strand as a template and starts from its \(3^{\prime}\) end to synthesize a new mRNA strand.
05

Apply the base-pairing rules for RNA

The base-pairing rules for RNA are as follows: - Adenine (A) in DNA pairs with Uracil (U) in RNA - Thymine (T) in DNA pairs with Adenine (A) in RNA - Cytosine (C) in DNA pairs with Guanine (G) in RNA - Guanine (G) in DNA pairs with Cytosine (C) in RNA Using these rules, we can determine the mRNA base sequence.
06

Write the mRNA base sequence

The mRNA base sequence is: \(5^{\prime} \mathrm{AUGUUUAGAGUAAACAUATCCU} 3^{\prime}\) So, the mRNA base sequence is: \(5^{\prime} \mathrm{AUGUUUAGAGUAAACAUATCCU} 3^{\prime}\) #c) Finding the amino acids represented by the mRNA sequence#
07

Divide the mRNA sequence into codons

Codons are groups of three nucleotide bases that code for an amino acid. Starting at the \(5^{\prime}\) end, divide the mRNA sequence into codons: AUG - UUU - AGA - GUA - AAC - AUA - UCC - U
08

Use the genetic code to find the corresponding amino acids

Using a genetic code table, we can translate each codon into an amino acid. Note that there is one incomplete codon at the end, which will not translate into an amino acid. - AUG = Methionine (Met) - UUU = Phenylalanine (Phe) - AGA = Arginine (Arg) - GUA = Valine (Val) - AAC = Asparagine (Asn) - AUA = Isoleucine (Ile) - UCC = Serine (Ser)
09

Write the amino acid sequence

The amino acid sequence corresponding to the given mRNA sequence is: Met - Phe - Arg - Val - Asn - Ile - Ser So, the amino acids represented by the sequence are: Methionine, Phenylalanine, Arginine, Valine, Asparagine, Isoleucine, and Serine.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Base Pairing Rules
Understanding base pairing rules is key to working with DNA and RNA. These rules describe how nucleotide bases pair up in DNA and RNA structures, ensuring accurate replication and transcription. In DNA, adenine (A) always pairs with thymine (T), and cytosine (C) pairs with guanine (G). Hence, if you have a sequence like \(3^{\prime} \text{TACAAATCTC}...5^{\prime}\), its complementary strand forms as \(5^{\prime} \text{ATGTTTAGAG}...3^{\prime}\).

For RNA, which plays a vital role in protein synthesis, the pairing is slightly different: adenine (A) pairs with uracil (U), instead of thymine (T), while cytosine (C) remains paired with guanine (G). This difference is crucial for the transcription process as it ensures RNA can properly encode the genetic information from DNA.
mRNA Synthesis
mRNA synthesis, known as transcription, is the process of copying a segment of DNA into RNA. This step is vital for expressing the genetic instructions stored in DNA. Transcription begins at the \(3^{\prime}\) end of a DNA strand.

Using the original segment, such as \(3^{\prime} \text{TACAAATCTC}...5^{\prime}\), RNA polymerase works along the strand from 3' to 5', synthesizing a complementary mRNA sequence from 5' to 3'. Unlike DNA, mRNA substitutes uracil (U) for thymine (T), resulting in a sequence like \(5^{\prime} \text{AUGUUUAGAG}...3^{\prime}\).
mRNA serves as the messenger that conveys genetic information from the nucleus to the ribosome, where proteins are synthesized.
Genetic Code Translation
Genetic code translation is how cells read and interpret the genetic instructions contained in mRNA. This process involves converting mRNA codons, which are sets of three nucleotides, into a sequence of amino acids, creating proteins. Each codon corresponds to a specific amino acid, as illustrated in a genetic code table.

For instance, an mRNA sequence like \(5^{\prime} \text{AUGUUUAGAG}...3^{\prime}\) translates into codons \(\text{AUG, UUU, AGA, ...}\). These codons code for amino acids:
  • AUG = Methionine (Met)
  • UUU = Phenylalanine (Phe)
  • AGA = Arginine (Arg)
The sequence is then translated into a chain of amino acids, eventually folding and forming functional proteins that carry out cellular functions. Understanding this translation process is vital for grasping how genetic information results in the complex structures and activities within cells.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free