Chapter 27: Q5P (page 1030)
In the genetic code used by mitochondria in many species, UGA codes for tryptophan rather than a Stop signal. How does mitochondrial translation terminate?
Mitochondria uses other Stop codons, namely UAA and UAG, instead of UGA.
Over 30 million students worldwide already upgrade their learning with Vaia!
All the tools & learning materials you need for study success - in one app.
Get started for free
Cells can make certain oligopeptides using conventional enzymes rather than mRNA-directed translation by a ribosome. Draw the product of the reaction catalyzed by L-glutamate: L-cysteine gamma-ligase
In eukaryotes, the primary rRNA transcript is an45 S rRNA that includes the sequences of the 18 S and 28 S rRNAs separated by short spacers. What is the advantage of this operon-like arrangement of rRNA genes?
Describe the similarities and differences between prokaryotic and eukaryotic ribosomes.
A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).
AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT
(a). Identify the DNA sequence that encodes each peptide.
(b). Determine the amino acid sequence of each peptide.
(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.
All cells contain an enzyme called peptidyl-tRNA hydrolase, and cells that are deficient in the enzyme grow very slowly. What is the probable function of the enzyme and why is it necessary?
What do you think about this solution?
We value your feedback to improve our textbook solutions.
