Chapter 27: Q5CP (page 988)
Which codons serve as punctuation signals?
The initiation codons and the stop codons serve as punctuation signals.
Over 30 million students worldwide already upgrade their learning with Vaia!
All the tools & learning materials you need for study success - in one app.
Get started for free
How is ATP used to charge a tRNA?
A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).
AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT
(a). Identify the DNA sequence that encodes each peptide.
(b). Determine the amino acid sequence of each peptide.
(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.
Cells can make certain oligopeptides using conventional enzymes rather than mRNA-directed translation by a ribosome. Draw the product of the reaction catalyzed by L-glutamate: L-cysteine gamma-ligase
What is the function of the RNA component of the SRP?
EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.
Aminoacyl–tRNA | Dissociation Constant (nM) |
Ala–tRNAAla | 6.2 |
Gln–tRNAAla | 0.05 |
Gln–tRNAGln | 4.4 |
Ala–tRNAGln | 260 |
What do you think about this solution?
We value your feedback to improve our textbook solutions.
