Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

The flu virus maximizes the use of its limited (13.5 kB) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.

– GAUUCCUUUCGUCAGUCCGAGA –

Short Answer

Expert verified

The normal polypeptide sequence of the given codon will be:

Asp-Ser-Phe-Arg-Gln-Ser-Glu

The sequence with the frameshift will be:

Asp-Ser-Phe-Val-Ser-Pro-Arg

Step by step solution

01

Polypeptide

Polypeptides form continuous unbranched chain of amino acids linked by peptide bonds. An amide can be created when the peptide bond links the carboxyl group of one amino acid to the amine group of the next amino acid.

02

Determining the normal polypeptide sequence

The given normal polypeptide sequence of flu virus is -GAUUCCUUUCGUCAGUCCGAGA-

.

The normal polypeptide sequence of the given codon will be:

Asp-Ser-Phe-Arg-Gln-Ser-Glu

The sequence with the frameshift will be:

Asp-Ser-Phe-Val-Ser-Pro-Arg

Here frameshift causes change in the 4 amino acids in the C terminal region.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free