Chapter 27: Q12CP (page 995)
Why don't cells need one tRNA for each codon?
Cells don't need one tRNA for each codon because the genetic code contains multiple codons that specify the same amino acid, and hence, one tRNA has the capacity to code more than one codon.
Over 30 million students worldwide already upgrade their learning with Vaia!
All the tools & learning materials you need for study success - in one app.
Get started for free
Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.
An antibiotic named fixmycin, which you have isolated from a fungus growing on ripe passion fruit, is effective in curing several types of sexually transmitted diseases. In characterizing fixmycinโs mode of action, you have found that it is a bacterial translational inhibitor that binds exclusively to the large subunit of E. coli ribosomes. The initiation of protein synthesis in the presence of Fixmycin results in the generation of dipeptides that remain associated with the ribosome. Suggest a mechanism of fixmycin action.
The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codonโanticodon pairing (Fig. 27-32). Propose an explanation for the antibiotic e๏ฌect of paromomycin.
The flu virus maximizes the use of its limited (13.5 kB) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
โ GAUUCCUUUCGUCAGUCCGAGA โ
Which translation protein mimics RNA structures and why?
What do you think about this solution?
We value your feedback to improve our textbook solutions.
