Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Q21P

Page 1030

One cause of the neurodegenerative disease amyotropic, lateral sclerosis (ALS) is the expansion of the repeating hexanucleotide sequence GGGGCC in the noncoding region of a gene. By unknown mechanisms, the repeating sequence is translated to generate neurotoxic peptides. Predict the sequences of the possible repeating dipeptides.

Q22CP

Page 1024

How does the ribosome catalyze peptide bond formation?

Q22P

Page 1030

The flu virus maximizes the use of its limited (13.5 kB) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.

– GAUUCCUUUCGUCAGUCCGAGA –

Q23CP

Page 1024

Summarize the role of GTP hydrolysis in promoting the efficiency of translation initiation, decoding, translocation, and chain termination.

Q23P

Page 1030

A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT

(a). Identify the DNA sequence that encodes each peptide.

(b). Determine the amino acid sequence of each peptide.

(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

Q24CP

Page 1024

Which translation protein mimics RNA structures and why?

Q25CP

Page 1024

How does the ribosome verify correct tRNA–mRNA pairing?

Q25P

Page 1030

EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.

Aminoacyl–tRNA

Dissociation Constant (nM)

Ala–tRNAAla

6.2

Gln–tRNAAla

0.05

Gln–tRNAGln

4.4

Ala–tRNAGln

260

Q26CP

Page 1024

What mechanism ensures that the ribosome translocates by exactly three nucleotides?

Q26P

Page 1030

The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codon–anticodon pairing (Fig. 27-32). Propose an explanation for the antibiotic effect of paromomycin.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks