Chapter 3: Q6P (page 77)
Question: Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzedreactions?
(a)
(b)
Short Answer
The correct answer is .
Chapter 3: Q6P (page 77)
Question: Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzedreactions?
(a)
(b)
The correct answer is .
All the tools & learning materials you need for study success - in one app.
Get started for freeDraw the tautomeric form of adenine.
Explain why the double-stranded nature of DNA is relevant for copying and transmitting genetic information when a cell divides.
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG
Explain how restriction enzymes generate either sticky ends or blunt ends.
A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box).
(a) Since everyone has two copies of each chromosome and therefore two alleles of each gene, what accounts for the appearance of only one allele at some loci?
(b) Which suspect is a possible source of the blood?
(c) Could the suspect be identified using just one of the three STR loci?
(d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?
What do you think about this solution?
We value your feedback to improve our textbook solutions.