Question

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG

Short answer

The two 12 residue primers are CTGACCAGCGCC and TATCCGTATCCG used to amplify the DNA segment by PCR.

Step-by-step solution

Introduction

The primers are short single-stranded DNA segments that are complementary to the 3ˈ end of a polynucleotide, and the DNA polymerase binds the hybridized RNA-DNA duplex. The polymerase is then used to add nucleotides that are complementary to the template strand, lengthening the DNA molecules in a 5ˈ to 3ˈ direction.

Two 12 residue primers are used to amplify the given DNA segment by PCR

The two nitrogen-containing portions of a nucleotide that link together to connect DNA or RNA strands are known as complementary bases. DNA and RNA are both made up of nucleotides, which are complex molecules important in genetics.

The following is the complementary strand of the given sequence:

TATCCGTATCCGGGTATACCGTATTCCGAAATATTATACGCTATCCGCGACCAGTC

The sequence of two 12 residue primers is,

CTGACCAGCGCC and TATCCGTATCCG