Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

Chapter 3: Nucleotides, Nucelic Acids, and Genetic Information

Q3.

Page 77

In many organisms, DNA is modified by methylation. Draw the structure of 5-methylcytosine, a base that occurs with high frequency in inactive DNA.

Q30P

Page 78

Hypoxanthine can also base-pair with cytosine. Draw the structure of this base pair.

Q31.

Page 78

Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is added or (b) too much ddNTP is added.

Q32P.

Page 78

Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.

Q33.

Page 78

Calculate the number of clones required to obtain with a probability of 0.99 a specific 5-kb fragment from C. elegans (Table 3-3).

Q34P

Page 78

You are attempting to clone a 250-kb segment of mouse DNA in a yeast artificial chromosome. You obtain 5000 similar-sized clones representing the entire mouse genome. How confident are you that you have cloned the DNA you are interested in?

Q35.

Page 78

Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture and (b) one of the primers is complementary to several sites in the starting DNA sample.

Q36P.

Page 78

Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.

Q37P

Page 78

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG

Q38.

Page 78

A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box).

(a) Since everyone has two copies of each chromosome and therefore two alleles of each gene, what accounts for the appearance of only one allele at some loci?

(b) Which suspect is a possible source of the blood?

(c) Could the suspect be identified using just one of the three STR loci?

(d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Get Vaia Premium now
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks