Question

In addition to the standard base-paired helical structures (e.g., Fig. 24-2), DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson-Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.

Short answer

The cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC is given below:

Step-by-step solution

Definition of Concept

The cruciform structure is similar to the X shape. It is made up of inverted repeats.

Inverted repeats are single-strand sequences that are followed downstream by an inverted version of themselves.

Step 2:Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC

In the given sequence, we must find the part of an inverted repeat: TCAAGTCCACGGTGGACTTGC.

We can accomplish this by joining the sequence's end and beginning. For example, in this case, the starting point is T and the ending base is C. They are unable to form Watson-Crick pairs (Watson-Crick pairs only include $\text{C.G and T.A)}$.

As a result, we continue to test bases from beginning to end until we find Watson-Crick pairs.

TCAAGTCCA CGGTGGACTTGC is the inverted repeat for cruciform structure.