Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

M. Klemke et al. (2001) discovered an interesting coding phenomenon in which an exon within a neurologic hormone receptor gene in mammals appears to produce two different protein entities (XL \(\alpha\) s, ALEX). Following is the DNA sequence of the exon's \(5^{\prime}\) end derived from a rat. The lowercase letters represent the initial coding portion for the XL \(\alpha\)s protein, and the uppercase letters indicate the portion where the ALEX entity is initiated. (For simplicity, and to correspond with the RNA coding dictionary, it is customary to represent the noncoding, nontemplate strand of the DNA segment.) \(5^{\prime}-\) gtcccaaccatgcccaccgatcttccgcctgcttctgaagATGCGGGCCCAG (a) Convert the noncoding DNA sequence to the coding RNA sequence. (b) Locate the initiator codon within the XL \(\alpha\) segment. (c) Locate the initiator codon within the ALEX segment. Are the two initiator codons in frame? (d) Provide the amino acid sequence for each coding sequence. In the region of overlap, are the two amino acid sequences the same? (e) Are there any evolutionary advantages to having the same DNA sequence code for two protein products? Are there any disadvantages?

Short Answer

Expert verified
Answer: A possible evolutionary advantage is that it saves space in the genome by efficiently using the genetic material, potentially allowing for divergent evolution of the protein products and leading to new functions without affecting the original function.

Step by step solution

01

(Step 1 - Convert the DNA sequence to RNA sequence)

First, we need to convert the given DNA sequence to an RNA sequence by replacing thymine (T) with uracil (U). The given DNA sequence is: gtcccaaccatgcccaccgatcttccgcctgcttctgaagATGCGGGCCCAG The corresponding RNA sequence would be: gucccaaccaugcccaccgaucuuccgccugcuucugaggAUGCUGGGCCCAG
02

(Step 2 - Locate the initiator codon within the XL α segment)

The initiator codon for proteins is AUG. In the XL α segment, the lowercase letters represent the coding portion. So, for XL α, we look for an AUG in the lowercase segment: gucccaaccaugcccaccgaucuuccgccugcuucugagg The initiator codon AUG is found at position 9-11 (caugcc).
03

(Step 3 - Locate the initiator codon within the ALEX segment and check if they are in frame)

Similarly, locate the initiator codon AUG in the uppercase segment for ALEX: AUGCUGGGCCCAG The initiator codon AUG is found at the beginning. The distance between the start of the two initiator codons is: 9 (the position of the first AUG) - 1 (the position of the second AUG) = 8 Since the difference is not a multiple of three (the reading frame is 3 nucleotides per codon), the two initiator codons are not in frame.
04

(Step 4 - Provide the amino acid sequence and check if they are the same in the overlapping region)

Translate the RNA sequence into the corresponding amino acid sequence using the genetic code. For the XLα segment: 9-11: AUG = Methionine (Met) 12-14: GCC = Alanine (Ala) 15-17: CAC = Histidine (His) ... For the ALEX segment: 1-3: AUG = Methionine (Met) 4-6: CUG = Leucine (Leu) 7-9: GGG = Glycine (Gly) ... Compare the amino acid sequences in the overlapping region, and we can see that they are different.
05

(Step 5 - Evaluate evolutionary advantages and disadvantages)

Some possible evolutionary advantages of having the same DNA sequence code for two protein products include: 1. Saves space in the genome by efficiently using the genetic material. 2. Can allow for divergent evolution of the protein products, potentially leading to new functions without alterations to the original function. On the other hand, disadvantages may include: 1. A single mutation in the shared sequence could affect both protein products, potentially detrimental to the organism. 2. The regulation of gene expression for the two protein products could be more complex, as changes in transcription factors or other regulatory elements may have unintended consequences on both proteins.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Code
The genetic code is fundamental to the process of life, informing the translation of genetic material into the proteins that perform numerous functions in living organisms. It's akin to a library of life, where each 'word' or codon, a sequence of three nucleotides, corresponds to a specific amino acid, the building blocks of proteins. This code is nearly universal across all species, highlighting the interconnectedness of life on Earth.

In our exercise, where an exon within a gene can encode two different proteins, the genetic code is used to decode the RNA to produce the amino acid sequence for each protein. Each set of three nucleotides, or triplet, in the RNA sequence is 'read' to find the corresponding amino acid. This process is similar to using a dictionary to translate words from one language to another, ensuring the correct protein is synthesized from the genetic instructions.
RNA Transcription
RNA transcription is the first step in the central dogma of molecular biology, where the information encoded in a DNA sequence is transcribed to create messenger RNA (mRNA). Essentially, it's like copying down notes from a textbook so that you can study them later without having to carry the book itself.

The exercise example requires the conversion of the DNA sequence in the noncoding strand to its corresponding mRNA sequence. This involves replacing 'T' for thymine with 'U' for uracil, as RNA uses uracil instead of DNA's thymine. The resulting RNA strand can then be used as a template for protein synthesis. This transcription step is crucial, as it sets the stage for the production of the proteins that dictate cellular functions.
Initiator Codon
The initiator codon is like the 'start' button of protein synthesis. For many organisms, including mammals, the codon AUG serves as the signal for the translation machinery to begin translating an mRNA sequence into an amino acid chain. In our exercise, the location of the AUG codon within the overlapping genes determines where the construction of each protein begins.

Typically, the first AUG codon found in the mRNA sequence after the 5' untranslated region is recognized as the start codon. In the context of the exercise, identifying the initiator codon for each protein tells us where the machinery will 'start reading' the genetic information to synthesize distinct proteins.
Amino Acid Sequence
Once the start codon has been identified, the subsequent codons are translated into an amino acid sequence, which folds to form a specific protein. This sequence is crucial, as the structure and function of a protein are determined by the order of amino acids in its chain.

In the exercise solution, after finding the initiator codon, the remaining codons are translated into the respective amino acid sequences for each protein. Even in the overlapping regions of the genes, the amino acid sequences can differ due to variations in reading frames, affecting the resulting protein structures and functions.
Evolutionary Advantages of Gene Overlap
Overlapping genes may seem like a compact design in the genomic blueprint, offering multiple outputs from a single stretch of DNA. This compactness is an evolutionary advantage because it ensures efficient use of genetic material and can lead to the multifunctionality of genetic sequences.

In environments where genetic economy is favored, overlapping genes offer a way to store more information in less space, which could conserve energy during replication and possibly provide a quicker response to environmental changes. However, this evolutionary strategy comes with trade-offs, such as a higher risk of pleiotropic effects, where a single mutation could disrupt multiple proteins simultaneously.
Reading Frame
Imagine reading a sentence where every third letter forms a word; this is akin to a reading frame in genetics, a way of dividing the sequence of nucleotides in a DNA or RNA molecule into a set of consecutive, non-overlapping triplets or codons. Each reading frame has the potential to encode a different amino acid sequence and, therefore, a different protein.

In our example, the two initiator codons not being in the same frame suggests the genetic information is 'read' differently, resulting in distinct proteins despite the overlap. This difference is crucial as it allows the same segment of DNA to encode for more than one protein, demonstrating the incredible flexibility and efficiency of the genetic code.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Sydney Brenner argued that the code was nonoverlapping because he considered that coding restrictions would occur if it were overlapping. A second major argument against an overlapping code involved the effect of a single nucleotide change. In an overlapping code, how many adjacent amino acids would be affected by a point mutation? In a nonoverlapping code, how many amino acid(s) would be affected?

Predict the amino acid sequence produced during translation by the following short hypothetical mRNA sequences (note that the second sequence was formed from the first by a deletion of only one nucleotide): Sequence 1: 5'-AUGCCGGAUUAUAGUUGA-3' Sequence \(2: 5^{\prime}-\) AUGCCGGAUUAAGUUGA-3' What type of mutation gave rise to Sequence 2 ?

The concept of consensus sequences of DNA was defined in this chapter as sequences that are similar (homologous) in different genes of the same organism or in genes of different organisms. Examples were the Pribnow box and the -35 region in prokaryotes and the TATA-box region in eukaryotes. One study found that among 73 isolates from the virus HIV-Type \(1 \mathrm{C}\) (a major contributor to the AIDS epidemic), a GGGNNNNNCC consensus sequence exists (where \(\mathrm{N}\) equals any nitrogenous base) in the promoter-enhancer region of the \(\mathrm{NF}-\kappa \mathrm{B}\) transcription factor, a cis- acting element that is critical for initiating HIV transcription in human macrophages (Novitsky et al., 2002 ). The authors contend that finding this and other conserved sequences may be of value in designing an AIDS vaccine. What advantages would knowing these consensus sequences confer? Are there disadvantages as a vaccine is designed?

Review the Chapter Concepts list on \(\mathrm{p} .342 .\) These all center around how genetic information is stored in DNA and transferred to RNA prior to translation into proteins. Write a short essay that summarizes the key properties of the genetic code and the process by which \(\mathrm{RNA}\) is transcribed on a DNA template.

In a mixed copolymer experiment, messages were created with either \(4 / 5 \mathrm{C}: 1 / 5 \mathrm{A}\) or \(4 / 5 \mathrm{A}: 1 / 5 \mathrm{C}\). These messages yielded proteins with the following amino acid compositions. Using these data, predict the most specific coding composition for each amino acid.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free