Chapter 15: Q. 4 (page 391)
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
a. complementarity
b. nonsense codons
c. universality
d. degeneracy
Short Answer
Option D is the correct answer.
Chapter 15: Q. 4 (page 391)
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
a. complementarity
b. nonsense codons
c. universality
d. degeneracy
Option D is the correct answer.
All the tools & learning materials you need for study success - in one app.
Get started for freeWhat transcripts will be most affected by low levels of ฮฑ-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
What processing step enhances the stability of pretRNAs and pre-rRNAs?
a. methylation
b. nucleotide modification
c. cleavage
d. splicing
What transcripts will be most affected by low levels of ฮฑamanitin?
a. 18S and 28S rRNAs
b. pre-mRNAs
c. 5S rRNAs and tRNAs
d. other small nuclear RNAs
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated
What do you think about this solution?
We value your feedback to improve our textbook solutions.