Chapter 15: Q. 29 (page 393)
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Short Answer
Met – Val – Ile – Thr – His – Glu – Ala (Original mRNA translation)
Met – Val – Asn – Asn – Thr (mutated mRNA translation)