Question

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Short answer

ACUAUCUUCGUGAGAUG

Step-by-step solution

Step 1. Introduction

Transcription is the process of copying of information from DNA strands into messenger RNA. It is simply a synthesis of RNA from a DNA template.

Step 2. Explanation

ACUAUCUUCGUGAGAUG

By analyzing the DNA sequence, it can be noted that there is a -10 consensus sequence near the 3’ end of the fragment. If we then estimate downstream, the +1 initiation site is the T instantly following the sequence AAT. This signifies the DNA fragment that will act as the template for transcription has the sequence TGATAGAAGCACTCTAC.

These bases form specific cytosine pairs with guanine and thymine with adenine. In RNA Uracil is present instead of Thymine.

ACUAUCUUCGUGAGAUG is a transcribed mRNA.