Question

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Short answer

Met Cys Arg Asn Ser Arg

Step-by-step solution

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

Step 2. Explanation

Amino acids writing first begins with the start codon AUG. Then the nucleotide sequences are separated in triplets. Then these triplets are translated into amino acids and translation stops at stop codon UGA.

Codon mention in question will for sequence Met Cys Arg Asn Ser Arg.