Chapter 15: Q. 17 (page 392)
In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200
Option a is correct.
Over 30 million students worldwide already upgrade their learning with Vaia!
All the tools & learning materials you need for study success - in one app.
Get started for free
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
. Which event contradicts the central dogma of molecular biology?
a. Poly-A polymerase enzymes process mRNA in the nucleus.
b. Endonuclease enzymes splice out and repair damaged DNA.
c. Scientists use reverse transcriptase enzymes to make DNA from RNA.
d. Codons specifying amino acids are degenerate and universal.
What transcripts will be most affected by low levels of ฮฑ-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
A fragment of bacterial DNA reads: 3โ โTACCTATAATCTCAATTGATAGAAGCACTCTACโ 5โ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
What do you think about this solution?
We value your feedback to improve our textbook solutions.
