Chapter 15: Q. 11 (page 392)
What transcripts will be most affected by low levels of α-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
Short Answer
Option b is correct.
Chapter 15: Q. 11 (page 392)
What transcripts will be most affected by low levels of α-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
Option b is correct.
All the tools & learning materials you need for study success - in one app.
Get started for freeA scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
15. A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail?
a. 220bp
b. 295bp
c. 140bp
d. 435bp
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
What do you think about this solution?
We value your feedback to improve our textbook solutions.