Chapter 15: Q. 10 (page 391)
Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences
Short Answer
Option b is correct.
Chapter 15: Q. 10 (page 391)
Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences
Option b is correct.
All the tools & learning materials you need for study success - in one app.
Get started for freeThe RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum
What processing step enhances the stability of pretRNAs and pre-rRNAs?
a. methylation
b. nucleotide modification
c. cleavage
d. splicing
Which pre-mRNA processing step is important for initiating translation?
a. poly-A tail
b. RNA editing
c. splicing
d. 7-methylguanosine cap
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
Figure 15.13Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.
What do you think about this solution?
We value your feedback to improve our textbook solutions.