Chapter 15: 5.question (page 391)
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
Short Answer
In each of the 12 codons of mRNA, there are 36 nucleotide bases.
Chapter 15: 5.question (page 391)
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
In each of the 12 codons of mRNA, there are 36 nucleotide bases.
All the tools & learning materials you need for study success - in one app.
Get started for free15. A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail?
a. 220bp
b. 295bp
c. 140bp
d. 435bp
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated
Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences
The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.
a. they are identical in all bacterial species b. they are similar in all bacterial species
c. they exist in all organisms
d. they have the same function in all organisms
What do you think about this solution?
We value your feedback to improve our textbook solutions.