Chapter 15: 5.question (page 391)
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
Short Answer
In each of the 12 codons of mRNA, there are 36 nucleotide bases.
Chapter 15: 5.question (page 391)
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
In each of the 12 codons of mRNA, there are 36 nucleotide bases.
All the tools & learning materials you need for study success - in one app.
Get started for free15. A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail?
a. 220bp
b. 295bp
c. 140bp
d. 435bp
What processing step enhances the stability of pretRNAs and pre-rRNAs?
a. methylation
b. nucleotide modification
c. cleavage
d. splicing
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated
In your own words, describe the difference between rho dependent and rho-independent termination of transcription in prokaryotes.
The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum
What do you think about this solution?
We value your feedback to improve our textbook solutions.