Warning: foreach() argument must be of type array|object, bool given in /var/www/html/web/app/themes/studypress-core-theme/template-parts/header/mobile-offcanvas.php on line 20

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Short Answer

Expert verified

Following all processes of DNA sequence transcription, we discovered that the bacterial 3' - TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5' fragment DNA gives us the mRNA sequence ACUAUCUUCGUGAGAUG.

Step by step solution

01

steo-1: Definition

RNA polymerase performs DNA transcription, which is the process of copying information from a DNA strand to mRNA for further translation.

02

step-2: Introduction

In the transcription process, RNA polymerase binds to promoters on DNA sequences and starts the process.

03

step-3: Explanation

The RNA polymerase enzyme, which is complementary to the DNA template, creates the mRNA strand. The transcription initiation complex, which is made up of transcription factors and RNA polymerase, kicks off mRNA synthesis by matching complimentary nucleotides to the DNA template. In the direction of 5'3', RNA polymerase constructs RNA stands.

Promoters, which are generally found upstream of genes, govern transcription and bind with RNA polymerase, forming a transcription machinery. It is critical to determine the exact sequence of a promoter that indicates whether or not the related gene has been transcribed frequently or infrequently.

Because it shares a binding domain, the consensus sequence must be deciphered by assembling nucleotide sequences with similar functions and locating a common nucleotide at each place. There are two common consensus sequences found in all bacterium species: a -10 sequence and a -35 sequence. TATAAT begins the 10-sequence, while TTGACA begins the 35-sequence. Both sequences have a binding site for an RNA polymeraseα subunit, and once the binding site was reorganized, the αsubunit was removed from the polymerase.

Now, consider the following bacterial DNA strand:

3'-TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5'.

First, we must identify the consensus sequence that will promote the RNA polymerase binding site. A ten-sequence TATAAT can be found at the end of the DNA sequence. As a result, the + 1 transcription initiation site is present after T in the sequence AAT. It signifies that the segments from which DNA sequence transcription begins are TGATAGAAGCACTCTAC.

In this sequence, uracil (U) is used as a complimentary base instead of thymine (T), resulting in the following transcribed mRNA sequence: ACUAUCUUCGUGAGAUG.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free