Chapter 21: Problem 3
The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
Short Answer
Expert verified
Answer: GCGCCUAGGAACUUAAGAUUUAUUUGGUAAAUUGGUGGUACUG
Step by step solution
01
Understand the base pairing rules for mRNA transcription
During transcription, the DNA sequence of the sense strand is used as a template to create a complementary mRNA transcript. Here are the base pairing rules for mRNA transcription:
- Adenine (A) in the DNA sequence pairs with uracil (U) in the RNA sequence
- Guanine (G) in the DNA sequence pairs with cytosine (C) in the RNA sequence
- Cytosine (C) in the DNA sequence pairs with guanine (G) in the RNA sequence
- Thymine (T) in the DNA sequence pairs with adenine (A) in the RNA sequence
02
Apply the base pairing rules to the given DNA sequence
Now, we'll apply the base pairing rules to the DNA sequence provided:
DNA: CGCGGATCCTTGAATTCTAAATAAACCATTTACCACCATGACC
Using the base pairing rules, we can generate the mRNA transcript as follows:
mRNA: GCGCCUAGGAACUUAAGAUUUAUUUGGUAAAUUGGUGGUACUG
Finally, the mRNA sequence is:
GCGCCUAGGAACUUAAGAUUUAUUUGGUAAAUUGGUGGUACUG
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with Vaia!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
DNA sequence
Understanding the DNA sequence is essential in genetics. DNA, or deoxyribonucleic acid, carries all the instructions used in the growth, development, functioning, and reproduction of all known living organisms. It is made up of nucleotides – each consisting of a phosphate group, a sugar group (deoxyribose), and a nitrogenous base. In a DNA sequence, these nucleotides are arranged in two long strands that form a double helix structure.
The order of these bases (adenine [A], thymine [T], cytosine [C], and guanine [G]) is what determines the genetic instructions. The sequence is read in a specific direction, typically from the 5' to the 3' end. In the given exercise, the DNA sequence represents the 'sense' strand, which is essentially the template that will be transcribed into RNA. This sequence is vital because it dictates the exact sequence of nucleotides in the mRNA, which will in turn determine the sequence of amino acids in a protein.
The order of these bases (adenine [A], thymine [T], cytosine [C], and guanine [G]) is what determines the genetic instructions. The sequence is read in a specific direction, typically from the 5' to the 3' end. In the given exercise, the DNA sequence represents the 'sense' strand, which is essentially the template that will be transcribed into RNA. This sequence is vital because it dictates the exact sequence of nucleotides in the mRNA, which will in turn determine the sequence of amino acids in a protein.
Base pairing rules
The base pairing rules are a cornerstone of molecular genetics. They dictate how nucleotide bases pair together – a concept crucial for DNA replication and transcription. These rules state that cytosine pairs with guanine (C-G) and adenine pairs with thymine (A-T) in DNA. However, during transcription into mRNA, adenine (A) is paired with uracil (U) instead of thymine.
Transcription Base Pairs:
- Adenine (DNA) to Uracil (mRNA)
- Guanine (DNA) to Cytosine (mRNA)
- Cytosine (DNA) to Guanine (mRNA)
- Thymine (DNA) to Adenine (mRNA)
Gene expression
Gene expression is the process by which information from a gene is used to synthesize a functional gene product, usually proteins. This process can be broken into two main stages: transcription and translation. In transcription, an mRNA molecule is produced based on the DNA sequence of a gene. This mRNA then serves as a blueprint for protein synthesis during translation.
Gene expression can be regulated at many stages from DNA to RNA to protein. Various factors influence expression, including the presence of transcription factors, the accessibility of the gene within the DNA structure, mRNA stability, and the efficiency of translation. The end result is the production of proteins, which carry out the functions that allow cells and organisms to live. For instance, in our exercise, the synthesized mRNA will guide the production of a specific protein.
Gene expression can be regulated at many stages from DNA to RNA to protein. Various factors influence expression, including the presence of transcription factors, the accessibility of the gene within the DNA structure, mRNA stability, and the efficiency of translation. The end result is the production of proteins, which carry out the functions that allow cells and organisms to live. For instance, in our exercise, the synthesized mRNA will guide the production of a specific protein.
Genetic code
The genetic code is the set of rules by which information encoded in genetic material (DNA or mRNA sequences) is translated into proteins by living cells. The code defines how sequences of three nucleotides, called codons, specify which amino acid will be added next during protein synthesis. There are 64 possible codons, each coding for one of the 20 amino acids used in proteins or a stop signal.
Because there are more codons than amino acids, the genetic code is said to be redundant, which means that some amino acids are encoded by more than one codon. Nevertheless, the code is nearly universal for all organisms and is critical for understanding how genes direct the production of proteins. For example, when the mRNA transcribed from the DNA sequence in our exercise is translated, the genetic code will determine the sequence of amino acids that form a protein.
Because there are more codons than amino acids, the genetic code is said to be redundant, which means that some amino acids are encoded by more than one codon. Nevertheless, the code is nearly universal for all organisms and is critical for understanding how genes direct the production of proteins. For example, when the mRNA transcribed from the DNA sequence in our exercise is translated, the genetic code will determine the sequence of amino acids that form a protein.